Rules of transcription and translation

Practice the expressing genes using the rules of transcription and translation.
Identify the type of mutation in a scenario and explain what the impact will be on the function of the protein.
Your initial post will give you the opportunity to transcribe and translate a wildtype and mutant DNA sequence. Afterwards, you should be able to make a prediction on how it might change the function of the protein. Use these instructions to craft your post but please do not post these instructions with your post to make it easier for everyone to review your work.

The following piece of DNA is the sense strand of a wildtype protein that codes for an enzyme.Begin by determining the mRNA and the protein sequence. Here is thecodon table(on the attachment) you will need fortranslation.

CCGCGAATGATAGAAAGGCCCTTTTAA

Next, Each mutant has only suffered one base substitution (marked in underline) from the wild type. Determine the new mRNA and the new protein sequence.

Mutant Asuffered a mutation at an amino acid that is normally located on theoutsideof this water soluble enzyme but not near its active site.

CCGCGAATGATAGAAAAGCCCTTTTAA
Antisense strand:
mRNA:
Protein:
Type of Mutation:

Mutant Bsuffered a mutation at an amino acid that is normally located on the theinsideof this water soluble enzyme but not near its active site.

CCGCGAATGGTAGAAAGGCCCTTTTAA
Antisense strand:
mRNA:
Protein:
Type of Mutation:

Mutant Csuffered a mutation at an amino acid that is normally located at the the active site of this enzyme where it normally forms an ionic bond with a divalent copper cation (Cu2 )

CCGCGAATGATAGGAAGGCCCTTTTAA
Antisense strand:
mRNA:
Protein:
Type of Mutation:

Mutant Dsuffered a mutation at an amino acid that is normally located at the the active site of this enzyme where it normally forms an ionic bond with a divalent copper cation (Cu2 )

CCGCGAATGATAGACAGGCCCTTTTAA
Antisense strand:
mRNA:
Protein:
Type of Mutation:

State the type of mutation that has occurred
Describe what impact would you predict that this mutation would have on this enzyme? You might need to reference thechemical structure of the amino acids(in the attachment) to make your predictions.

Place your order
(550 words)

Approximate price: $22

Calculate the price of your order

550 words
We'll send you the first draft for approval by September 11, 2018 at 10:52 AM
Total price:
$26
The price is based on these factors:
Academic level
Number of pages
Urgency
Basic features
  • Free title page and bibliography
  • Unlimited revisions
  • Plagiarism-free guarantee
  • Money-back guarantee
  • 24/7 support
On-demand options
  • Writer’s samples
  • Part-by-part delivery
  • Overnight delivery
  • Copies of used sources
  • Expert Proofreading
Paper format
  • 275 words per page
  • 12 pt Arial/Times New Roman
  • Double line spacing
  • Any citation style (APA, MLA, Chicago/Turabian, Harvard)

Our guarantees

Delivering a high-quality product at a reasonable price is not enough anymore.
That’s why we have developed 5 beneficial guarantees that will make your experience with our service enjoyable, easy, and safe.

Money-back guarantee

You have to be 100% sure of the quality of your product to give a money-back guarantee. This describes us perfectly. Make sure that this guarantee is totally transparent.

Read more

Zero-plagiarism guarantee

Each paper is composed from scratch, according to your instructions. It is then checked by our plagiarism-detection software. There is no gap where plagiarism could squeeze in.

Read more

Free-revision policy

Thanks to our free revisions, there is no way for you to be unsatisfied. We will work on your paper until you are completely happy with the result.

Read more

Privacy policy

Your email is safe, as we store it according to international data protection rules. Your bank details are secure, as we use only reliable payment systems.

Read more

Fair-cooperation guarantee

By sending us your money, you buy the service we provide. Check out our terms and conditions if you prefer business talks to be laid out in official language.

Read more
Open chat
1
You can contact our live agent via WhatsApp! Via + 1 3234125597

Feel free to ask questions, clarifications, or discounts available when placing an order.

Order your essay today and save 30% with the discount code GIFT